# Formal and stochastic grammars in ruby

**URL:** <https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164>\
**Category:** Ruby\
**Created:** [August 4, 2009, 8:22am UTC](https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164 "2009-08-04T08:22:20Z")\
**Posts on this page:** 3\
**Page:** 1

<div class="post-metadata">

**Author:** ![georgeuoa](https://www.ruby-forum.com/letter_avatar_proxy/v4/letter/g/7ab992/32.png) [@georgeuoa](https://www.ruby-forum.com/u/georgeuoa)\
**Post date:** [August 4, 2009, 8:22am UTC](https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164/1 "2009-08-04T08:22:20Z")

</div>

Hello,

Given a string,  
“gcgggcgggccgcggaaattacta” it may so happen that the gcgg substring is  
very important and it is repeated in strings of this nature.

I would like to replace all occurrences of “gcgg” with a new symbol call  
it B such that I can reduce the initial text to BggcgggccBaaattacta.

While i know it is possible to accomplish that using regular expressions  
and substitution,my wider aim is to develop a grammar for such a  
string,using a finite alphabet for example {A,G,C,T} in this case. Where  
A,G,C,T are terminal symbols and B is a nonterminal symbol. Ideally I  
would like to have a set of Production rules for generating such  
strings.

How easy or relevant is it to use ruby for deriving stochastic grammars  
and linguistics? Are there existing libraries for doing such things in  
ruby?

I am new to the world of grammar and stuff so please bear with me

Thank you.

George

---

<div class="post-metadata">

**Author:** ![georgeuoa](https://www.ruby-forum.com/letter_avatar_proxy/v4/letter/g/7ab992/32.png) [@georgeuoa](https://www.ruby-forum.com/u/georgeuoa)\
**Post date:** [August 4, 2009, 9:10pm UTC](https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164/2 "2009-08-04T21:10:33Z")

</div>

George G. wrote:

> Hello,
> 
> Given a string,  
> “gcgggcgggccgcggaaattacta” it may so happen that the gcgg substring is  
> very important and it is repeated in strings of this nature.
> 
> I would like to replace all occurrences of “gcgg” with a new symbol call  
> it B such that I can reduce the initial text to BggcgggccBaaattacta.
> 
> While i know it is possible to accomplish that using regular expressions  
> and substitution,my wider aim is to develop a grammar for such a  
> string,using a finite alphabet for example {A,G,C,T} in this case. Where  
> A,G,C,T are terminal symbols and B is a nonterminal symbol. Ideally I  
> would like to have a set of Production rules for generating such  
> strings.
> 
> How easy or relevant is it to use ruby for deriving stochastic grammars  
> and linguistics? Are there existing libraries for doing such things in  
> ruby?
> 
> I am new to the world of grammar and stuff so please bear with me
> 
> Thank you.
> 
> George

Well, I don’t know a whole lot about stochastic grammars in Ruby, but  
assuming your choice of terminal symbols was not wholly coincidental,  
you may find BioRuby [1] helpful.

If nucleotides really were just an arbitrary example and you’re actually  
looking for something broader, then, someone else here may have a  
suggestion.

[1] BioRuby: [http://bioruby.org/](http://bioruby.org/)

---

<div class="post-metadata">

**Author:** ![georgeuoa](https://www.ruby-forum.com/letter_avatar_proxy/v4/letter/g/7ab992/32.png) [@georgeuoa](https://www.ruby-forum.com/u/georgeuoa)\
**Post date:** [August 5, 2009, 9:25am UTC](https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164/3 "2009-08-05T09:25:23Z")

</div>

> Well, I don’t know a whole lot about stochastic grammars in Ruby, but  
> assuming your choice of terminal symbols was not wholly coincidental,  
> you may find BioRuby [1] helpful.
> 
> If nucleotides really were just an arbitrary example and you’re actually  
> looking for something broader, then, someone else here may have a  
> suggestion.
> 
> [1] BioRuby: [http://bioruby.org/](http://bioruby.org/)

Hi,Thanks for the reply, Bioruby unfortunately does not implement any of  
the stochastic or any grammars yet. While i used the example of  
nucleotide sequences, i am actually looking for something broader,  
though the nucleotide sequences problem would be a good start point.