# Ruby

**URL:** https://www.ruby-forum.com/c/ruby/7.md?page=770

[Latest](https://www.ruby-forum.com/latest.md) · [Categories](https://www.ruby-forum.com/categories.md) · [Tags](https://www.ruby-forum.com/tags.md)

**Page:** 771

---

## [Daemon helper](https://www.ruby-forum.com/t/daemon-helper/173262)

<div class="topic-metadata">

**Author:** [@John\_Kelly](https://www.ruby-forum.com/u/John_Kelly)\
**Replies:** 0\
**Last updated:** [August 5, 2009, 10:10pm UTC](https://www.ruby-forum.com/t/daemon-helper/173262 "2009-08-05T22:10:56Z")

</div>

daemon helper: start any program or script as a daemon. It’s a small C program with a simple interface and a liberal license. It already does what I want it to do; I am interested in correctness patches more than new …

---

## [\[Feature:1.9\] IPAddr#hash should consider a mask\_addr](https://www.ruby-forum.com/t/feature-1-9-ipaddr-hash-should-consider-a-mask-addr/173180)

<div class="topic-metadata">

**Author:** [@Nobuhiro\_IMAI](https://www.ruby-forum.com/u/Nobuhiro_IMAI)\
**Replies:** 2\
**Last updated:** [August 5, 2009, 5:17pm UTC](https://www.ruby-forum.com/t/feature-1-9-ipaddr-hash-should-consider-a-mask-addr/173180 "2009-08-05T17:17:40Z")

</div>

e$B$$$^$$$G$9!#e(B r24388 e$B$G$9$,!“%M%C%H%^%9%/$,9MN8$5$l$F$$$J$$$N$G!”%"%I%l%9$,F1$8$G%M%Ce(B e$B%H%^%9%/$,0c$&%\*%V%8%'%/%H$bF1$8$b$N$@$H$\_$J$5$l$F$7$^$$$^$9!#e(B a1 = IPAddr.new(“192.168.2.0/24”) =\> #\<IPAddr: …

---

## [Lone Star Ruby Conference 2009 - One more week before Late Registration Begins](https://www.ruby-forum.com/t/lone-star-ruby-conference-2009-one-more-week-before-late-registration-begins/173240)

<div class="topic-metadata">

**Author:** [@unknown](https://www.ruby-forum.com/u/unknown)\
**Replies:** 0\
**Last updated:** [August 5, 2009, 3:28pm UTC](https://www.ruby-forum.com/t/lone-star-ruby-conference-2009-one-more-week-before-late-registration-begins/173240 "2009-08-05T15:28:12Z")

</div>

Greetings from Austin - Home of the Lone Star Ruby Conference. Have you checked out the training classes and speakers at this years Lone Star Ruby Conference? It is probably the best Ruby conference to date. HugeDoma…

---

## [ParseException met when using Watir with xpath, please help](https://www.ruby-forum.com/t/parseexception-met-when-using-watir-with-xpath-please-help/173217)

<div class="topic-metadata">

**Author:** [@jacqueline](https://www.ruby-forum.com/u/jacqueline)\
**Replies:** 3\
**Last updated:** [August 5, 2009, 2:50pm UTC](https://www.ruby-forum.com/t/parseexception-met-when-using-watir-with-xpath-please-help/173217 "2009-08-05T14:50:11Z")

</div>

Hi all, I’m new here, and I met some problem while I was using Watir gem to automate my testcase. I want to use Watir with xpath, coding like this: require “watir” @ie = Watir::IE.new @ie.goto(“www.g.cn”)#google in…

---

## [Has anyoune tried Red Sun](https://www.ruby-forum.com/t/has-anyoune-tried-red-sun/173196)

<div class="topic-metadata">

**Author:** [@orenshani](https://www.ruby-forum.com/u/orenshani)\
**Replies:** 4\
**Last updated:** [August 5, 2009, 12:43pm UTC](https://www.ruby-forum.com/t/has-anyoune-tried-red-sun/173196 "2009-08-05T12:43:50Z")

</div>

Hi All, Have anyone tried the Red Sun Flash Ruby VM? It looks like a great concept, does anyone here have any experience with it? Thanks, Oren

---

## [Formal and stochastic grammars in ruby](https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164)

<div class="topic-metadata">

**Author:** [@georgeuoa](https://www.ruby-forum.com/u/georgeuoa)\
**Replies:** 2\
**Last updated:** [August 5, 2009, 9:25am UTC](https://www.ruby-forum.com/t/formal-and-stochastic-grammars-in-ruby/173164 "2009-08-05T09:25:23Z")

</div>

Hello, Given a string, “gcgggcgggccgcggaaattacta” it may so happen that the gcgg substring is very important and it is repeated in strings of this nature. I would like to replace all occurrences of “gcgg” with a new…

---

## [Parameter passed by get](https://www.ruby-forum.com/t/parameter-passed-by-get/173194)

<div class="topic-metadata">

**Author:** [@davidstokar](https://www.ruby-forum.com/u/davidstokar)\
**Replies:** 1\
**Last updated:** [August 5, 2009, 8:50am UTC](https://www.ruby-forum.com/t/parameter-passed-by-get/173194 "2009-08-05T08:50:06Z")

</div>

A third party has written a program that passes a parameter via the GET method. I need to use it to call a Ruby script and pass a parameter. I have researched and experimented for days and cannot figure out how to re…

---

## [Re: remove commas from string](https://www.ruby-forum.com/t/re-remove-commas-from-string/173223)

<div class="topic-metadata">

**Author:** [@unknown](https://www.ruby-forum.com/u/unknown)\
**Replies:** 0\
**Last updated:** [August 5, 2009, 8:15am UTC](https://www.ruby-forum.com/t/re-remove-commas-from-string/173223 "2009-08-05T08:15:39Z")

</div>

s.gsub(/\\d+(,)\\d+/, “”) It turns out that my regex removes the entire number, not just the comma. Er, yes, you asking to replace \\d+(,)\\d+ with nothing, that’s exactly what it does… Try something like this (typin…

---

## [Enumerator#peek](https://www.ruby-forum.com/t/enumerator-peek/172803)

<div class="topic-metadata">

**Author:** [@Tanaka\_A](https://www.ruby-forum.com/u/Tanaka_A)\
**Replies:** 15\
**Last updated:** [August 5, 2009, 7:53am UTC](https://www.ruby-forum.com/t/enumerator-peek/172803 "2009-08-05T07:53:59Z")

</div>

Enumerator#peek e$B$r?7@\_$9$k$N$O$I$&$G$7$g$&$+!#e(B Enumerator e$B$+$i%G!\<%?$rFI$=P$9$H$-!"@hFI$$r$7$?$/$J$k$3$H$,$"$j$^$9!#e(B e$B$?$H$($P!"%=!\<%H:Q$\_$NC18l$NNs$,$"$C$?$H$-$K!"3FC18l$N?t$r5ae(B e$B$a$?$$$H$9$k$H!"0…

---

## [Dummy\_gdb\_enums](https://www.ruby-forum.com/t/dummy-gdb-enums/173145)

<div class="topic-metadata">

**Author:** [@Yukihiro\_M](https://www.ruby-forum.com/u/Yukihiro_M)\
**Replies:** 3\
**Last updated:** [August 5, 2009, 7:53am UTC](https://www.ruby-forum.com/t/dummy-gdb-enums/173145 "2009-08-05T07:53:59Z")

</div>

e$B$^$D$b$He(B e$B$f$-$R$m$G$9e(B .gdbinite$B$Ke(B dummy\_gdb\_enums e$B$H$$$&L$Dj5AJQ?t$,;H$o$l$k$h$&$K$J$Ce(B e$B$F!"$;$C$+$/$Ne(B rp e$B%^%/%m$J$I$,;H$($J$/$J$C$F$$$^$9!#e(B (gdb) rp hash No symbol “dummy\_gdb\_enums…

---

## [Setting thread pool size for glassfish gem? (multithreaded)](https://www.ruby-forum.com/t/setting-thread-pool-size-for-glassfish-gem-multithreaded/173218)

<div class="topic-metadata">

**Author:** [@samckayak](https://www.ruby-forum.com/u/samckayak)\
**Replies:** 0\
**Last updated:** [August 5, 2009, 4:52am UTC](https://www.ruby-forum.com/t/setting-thread-pool-size-for-glassfish-gem-multithreaded/173218 "2009-08-05T04:52:30Z")

</div>

I’ve been using the glassfish gem for a few weeks now, running in multithread mode together with Rails 2.2.2 and JRuby 1.3.1. When applying a performance testing load, it seems as if there are never more than 5 http w…

---

## [Imap\_processor 1.3 Released](https://www.ruby-forum.com/t/imap-processor-1-3-released/173219)

<div class="topic-metadata">

**Author:** [@miracleofmagick](https://www.ruby-forum.com/u/miracleofmagick)\
**Replies:** 0\
**Last updated:** [August 5, 2009, 4:33am UTC](https://www.ruby-forum.com/t/imap-processor-1-3-released/173219 "2009-08-05T04:33:48Z")

</div>

imap\_processor version 1.3 has been released! http://seattlerb.rubyforge.org/imap\_processor IMAPProcessor is a client for processing messages on an IMAP server. It provides some basic mechanisms for connecting to an…

---

## [Why No QtRuby list under Misc?](https://www.ruby-forum.com/t/why-no-qtruby-list-under-misc/173211)

<div class="topic-metadata">

**Author:** [@matthewmurcia](https://www.ruby-forum.com/u/matthewmurcia)\
**Replies:** 2\
**Last updated:** [August 5, 2009, 3:00am UTC](https://www.ruby-forum.com/t/why-no-qtruby-list-under-misc/173211 "2009-08-05T03:00:47Z")

</div>

I was just wondering if anyone knew why several GUI dev tools (FX, wx-, Gnome 2) have sublists on this mailing list rather than others (Shoes, QtRuby, et cetera) Could we request a separate section just for GUI develo…

---

## [QtRuby Questions: Why does](https://www.ruby-forum.com/t/qtruby-questions-why-does/173210)

<div class="topic-metadata">

**Author:** [@matthewmurcia](https://www.ruby-forum.com/u/matthewmurcia)\
**Replies:** 3\
**Last updated:** [August 5, 2009, 2:42am UTC](https://www.ruby-forum.com/t/qtruby-questions-why-does/173210 "2009-08-05T02:42:18Z")

</div>

Guten Tag, everyone- I have finally found the time to sit down and attempt GUI programming with QtRuby. I am attempting to use QtRuby from within KDevelop to make a simple widget in Qt Designer, run the .ui file throu…

---

## [$B%;%-%e%j%F%#%b%G%k$N%I%-%e%a%s%H(B](https://www.ruby-forum.com/t/b-e-j-f-b-g-k-n-i-e-a-s-h-b/172286)

<div class="topic-metadata">

**Author:** [@Shugo\_M](https://www.ruby-forum.com/u/Shugo_M)\
**Replies:** 6\
**Last updated:** [August 5, 2009, 2:37am UTC](https://www.ruby-forum.com/t/b-e-j-f-b-g-k-n-i-e-a-s-h-b/172286 "2009-08-05T02:37:19Z")

</div>

e$BA0ED$G$9!#e(B e$BEDCf$5$s$K2q$&$?$S$K=q$1$H8@$o$l$k$N$G!“e(B$SAFEe$B$^$o$j$N%I%-%e%a%s%H$NC!$-Bf$re(B e$B:n$C$F$$^$7$?!#e(B e$B6X;$5$l$kA\`:n$N0lMw$O%j%U%!%l%s%9%^%K%e%”%k$+$i\<h$C$FMh$^$7$?$N$G!"\<BAu$H$Oe(B e$BP\*N%…

---

## [Using git for projects with multiple gems on rubyforge](https://www.ruby-forum.com/t/using-git-for-projects-with-multiple-gems-on-rubyforge/173074)

<div class="topic-metadata">

**Author:** [@Joel\_VanderWerf](https://www.ruby-forum.com/u/Joel_VanderWerf)\
**Replies:** 2\
**Last updated:** [August 5, 2009, 2:08am UTC](https://www.ruby-forum.com/t/using-git-for-projects-with-multiple-gems-on-rubyforge/173074 "2009-08-05T02:08:39Z")

</div>

Some rubyforge projects release more than one sequence of gems. Has anyone found a way to manage the source for multiple gems in the unique git repository for the project? Is it better to use github, with a separate r…

---

## [Loading precompiled code](https://www.ruby-forum.com/t/loading-precompiled-code/173192)

<div class="topic-metadata">

**Author:** [@Husam\_S](https://www.ruby-forum.com/u/Husam_S)\
**Replies:** 4\
**Last updated:** [August 5, 2009, 12:45am UTC](https://www.ruby-forum.com/t/loading-precompiled-code/173192 "2009-08-05T00:45:32Z")

</div>

Hi, Does ruby support storing and loading bytecode !! Thanks

---

## [Best way to implement animated chart in ruby](https://www.ruby-forum.com/t/best-way-to-implement-animated-chart-in-ruby/173149)

<div class="topic-metadata">

**Author:** [@di3go](https://www.ruby-forum.com/u/di3go)\
**Replies:** 6\
**Last updated:** [August 5, 2009, 12:42am UTC](https://www.ruby-forum.com/t/best-way-to-implement-animated-chart-in-ruby/173149 "2009-08-05T00:42:01Z")

</div>

I need to implement a animated chart in ruby, im using gtk. Anyone have a idea? The animation, needs to be smooth. Cairo? RMagick(too slow to draw a chart 30 times a second)? any other plot gem? anyone know one? Tha…

---

## [Python and ruby together?](https://www.ruby-forum.com/t/python-and-ruby-together/173186)

<div class="topic-metadata">

**Author:** [@Gwen\_M](https://www.ruby-forum.com/u/Gwen_M)\
**Replies:** 5\
**Last updated:** [August 4, 2009, 11:44pm UTC](https://www.ruby-forum.com/t/python-and-ruby-together/173186 "2009-08-04T23:44:05Z")

</div>

Is it possible to set up python scripts in such a way that they can parse ruby files? ie: I have a script written in ruby. I have 3rd party program that reads python scripts but not ruby scripts. I want the 3rd part…

---

## [Inconsistency in Array#\[\]](https://www.ruby-forum.com/t/inconsistency-in-array/173105)

<div class="topic-metadata">

**Author:** [@Wojciech\_P](https://www.ruby-forum.com/u/Wojciech_P)\
**Replies:** 13\
**Last updated:** [August 4, 2009, 9:19pm UTC](https://www.ruby-forum.com/t/inconsistency-in-array/173105 "2009-08-04T21:19:27Z")

</div>

Disclaimer: I know what docs say, but I’d prefer a different behaviour. I want to understand why this design decision was made. Some code first: irb(main):001:0\> a = \[1,2,3,4,5\] =\> \[1, 2, 3, 4, 5\] irb(main):002:0\> a…

---

## [\[Bug #1878\] testrb can not execute tests in sub directory](https://www.ruby-forum.com/t/bug-1878-testrb-can-not-execute-tests-in-sub-directory/173184)

<div class="topic-metadata">

**Author:** [@Naohisa\_G](https://www.ruby-forum.com/u/Naohisa_G)\
**Replies:** 1\
**Last updated:** [August 4, 2009, 8:37pm UTC](https://www.ruby-forum.com/t/bug-1878-testrb-can-not-execute-tests-in-sub-directory/173184 "2009-08-04T20:37:53Z")

</div>

Bug #1878: testrb can not execute tests in sub directory http://redmine.ruby-lang.org/issues/show/1878 e$B5/I\<\<Te(B: Naohisa G. e$B%9%F!\<%?%9e(B: Open, e$BM%@hEYe(B: Normal ruby -v: ruby 1.9.2dev (2009-07-18 trunk 24…

---

## [Mod\_ruby error reporting](https://www.ruby-forum.com/t/mod-ruby-error-reporting/173197)

<div class="topic-metadata">

**Author:** [@steux](https://www.ruby-forum.com/u/steux)\
**Replies:** 0\
**Last updated:** [August 4, 2009, 8:09pm UTC](https://www.ruby-forum.com/t/mod-ruby-error-reporting/173197 "2009-08-04T20:09:24Z")

</div>

Is there such thing? Can I get errors reports from rhtml pages instead of: Internal Server Error The server encountered an internal error or misconfiguration… Regards

---

## [Downloading large file with NET::SCP](https://www.ruby-forum.com/t/downloading-large-file-with-net-scp/173193)

<div class="topic-metadata">

**Author:** [@Husam\_S](https://www.ruby-forum.com/u/Husam_S)\
**Replies:** 0\
**Last updated:** [August 4, 2009, 7:57pm UTC](https://www.ruby-forum.com/t/downloading-large-file-with-net-scp/173193 "2009-08-04T19:57:28Z")

</div>

Hi, I’m trying write script to download files using NET:SCP, the APIs seems to work with small files, but the script seems stop after 4% when I download large file. Just want see if there is known problem with APIs.…

---

## [Method that runs an executable file](https://www.ruby-forum.com/t/method-that-runs-an-executable-file/173185)

<div class="topic-metadata">

**Author:** [@dezrtdude](https://www.ruby-forum.com/u/dezrtdude)\
**Replies:** 2\
**Last updated:** [August 4, 2009, 6:47pm UTC](https://www.ruby-forum.com/t/method-that-runs-an-executable-file/173185 "2009-08-04T18:47:17Z")

</div>

hello, i am quite new to programming, only began in february this year and am doing a project for my uni course. me and my group are using ruby on rails and were wondering if it is possible to create a method that wh…

---

## [Spreadsheet link to a file](https://www.ruby-forum.com/t/spreadsheet-link-to-a-file/173178)

<div class="topic-metadata">

**Author:** [@asasas](https://www.ruby-forum.com/u/asasas)\
**Replies:** 5\
**Last updated:** [August 4, 2009, 6:20pm UTC](https://www.ruby-forum.com/t/spreadsheet-link-to-a-file/173178 "2009-08-04T18:20:52Z")

</div>

Hi, I’m looking for a way to create a link to a local file with the spreadsheet gem. I can make a link to a site (see example below), but what is the syntax for a file? Thanks, %%%%% #!/usr/bin/env ruby require ‘r…

---

## [Java code to Ruby code?](https://www.ruby-forum.com/t/java-code-to-ruby-code/173168)

<div class="topic-metadata">

**Author:** [@little\_kostas](https://www.ruby-forum.com/u/little_kostas)\
**Replies:** 2\
**Last updated:** [August 4, 2009, 5:22pm UTC](https://www.ruby-forum.com/t/java-code-to-ruby-code/173168 "2009-08-04T17:22:55Z")

</div>

Hello guys, I dont know if it is the right place to ask about java but i have a problem. I am trying to “translate” some java code to ruby code for a project in my univercity. My professor gave me this java code an i…

---

## [\[OT\] Good web design](https://www.ruby-forum.com/t/ot-good-web-design/173141)

<div class="topic-metadata">

**Author:** [@stickstone](https://www.ruby-forum.com/u/stickstone)\
**Replies:** 8\
**Last updated:** [August 4, 2009, 5:22pm UTC](https://www.ruby-forum.com/t/ot-good-web-design/173141 "2009-08-04T17:22:19Z")

</div>

Sorry for the OT, but I figure there must be other people on this list who have been in the same boat as me. I’m looking for resources on good web design - by which I mean designing a website which is visually appeali…

---

## [Soap4r envelope issue](https://www.ruby-forum.com/t/soap4r-envelope-issue/173182)

<div class="topic-metadata">

**Author:** [@veeraa2003](https://www.ruby-forum.com/u/veeraa2003)\
**Replies:** 0\
**Last updated:** [August 4, 2009, 3:36pm UTC](https://www.ruby-forum.com/t/soap4r-envelope-issue/173182 "2009-08-04T15:36:55Z")

</div>

Hi all, I’m trying to create soap envelope where I can’t add my own attributes like tns, types etc. for example my service provider asking the envelope format like below, \<?xml version="1.0" encoding="utf-8"?\> \<soap:…

---

## [Display content depanding on url](https://www.ruby-forum.com/t/display-content-depanding-on-url/171178)

<div class="topic-metadata">

**Author:** [@henster](https://www.ruby-forum.com/u/henster)\
**Replies:** 6\
**Last updated:** [August 4, 2009, 3:20pm UTC](https://www.ruby-forum.com/t/display-content-depanding-on-url/171178 "2009-08-04T15:20:41Z")

</div>

Hi, I am sorry if this question has been answered before but I am unable to find the answer. What I would like to do is display the content of a page depending in the url, for example Whatever.UK would display: con…

---

## [Instant Rails Replacement?](https://www.ruby-forum.com/t/instant-rails-replacement/173133)

<div class="topic-metadata">

**Author:** [@jack](https://www.ruby-forum.com/u/jack)\
**Replies:** 6\
**Last updated:** [August 4, 2009, 2:19pm UTC](https://www.ruby-forum.com/t/instant-rails-replacement/173133 "2009-08-04T14:19:46Z")

</div>

Is there a standalone (non-installable) way to get Ruby to run? Instant Rails hasnt been updated in a long time. I dont have access to install Ruby at work, but I want to learn it in my free time. So if there is somet…

[Previous page](https://www.ruby-forum.com/c/ruby/7.md?page=769)

[Next page](https://www.ruby-forum.com/c/ruby/7.md?page=771)