# Ruby **URL:** https://www.ruby-forum.com/c/ruby/7.md?page=1241 [Latest](https://www.ruby-forum.com/latest.md) · [Categories](https://www.ruby-forum.com/categories.md) · [Tags](https://www.ruby-forum.com/tags.md) **Page:** 1242 --- ## [IF me like Ruby does](https://www.ruby-forum.com/t/if-me-like-ruby-does/125612)
**Author:** [@enduro](https://www.ruby-forum.com/u/enduro)\ **Replies:** 4\ **Last updated:** [January 10, 2008, 11:04pm UTC](https://www.ruby-forum.com/t/if-me-like-ruby-does/125612 "2008-01-10T23:04:51Z")
Hi there When fiddling together CSS classes in html\_options of my form helpers, I sometimes have code looking something like the following: html\_options.merge!(:class =\> “list\_item” + ((options\[:class\_method\])?(" lis… --- ## [Ruby\_version](https://www.ruby-forum.com/t/ruby-version/125645)
**Author:** [@editkid](https://www.ruby-forum.com/u/editkid)\ **Replies:** 1\ **Last updated:** [January 10, 2008, 10:51pm UTC](https://www.ruby-forum.com/t/ruby-version/125645 "2008-01-10T22:51:23Z")
Currently RUBY\_VERSION reports 1.0.0.0. This is set in Ruby.Runtime.RubyContext. public const string/\*!\*/ Version = "1.0.0.0"; What is the strategy for this value? Will it be set to the CRuby version that we a… --- ## [IS there a problem building usinf 3.5?](https://www.ruby-forum.com/t/is-there-a-problem-building-usinf-3-5/125643)
**Author:** [@CSKSPonnappa](https://www.ruby-forum.com/u/CSKSPonnappa)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 10:36pm UTC](https://www.ruby-forum.com/t/is-there-a-problem-building-usinf-3-5/125643 "2008-01-10T22:36:39Z")
I’m using Visual C# 2008 Compiler version 3.5.21022.8 to try to build, but csc simply terminates when I do a rake compile. Should I be using only the compiler which ships with.Net 2.0? Thanks, Sidu. – Two’s an SMS.… --- ## [Job opportunity](https://www.ruby-forum.com/t/job-opportunity/97342)
**Author:** [@Gennady\_B](https://www.ruby-forum.com/u/Gennady_B)\ **Replies:** 7\ **Last updated:** [January 10, 2008, 10:27pm UTC](https://www.ruby-forum.com/t/job-opportunity/97342 "2008-01-10T22:27:51Z")
Hi, rubyists The company I work at has an immediate opening for a person with solid C background and good automation skills (Ruby is allowed here :wink: ) to perfom white/grey box testing for the product. A Job Descri… --- ## [Netbeans or aptana?](https://www.ruby-forum.com/t/netbeans-or-aptana/125338)
**Author:** [@rabarama](https://www.ruby-forum.com/u/rabarama)\ **Replies:** 4\ **Last updated:** [January 10, 2008, 10:20pm UTC](https://www.ruby-forum.com/t/netbeans-or-aptana/125338 "2008-01-10T22:20:14Z")
for web development in ruby on rails, wich is the best for you? thanks --- ## [String extraction](https://www.ruby-forum.com/t/string-extraction/125639)
**Author:** [@alex-osu3](https://www.ruby-forum.com/u/alex-osu3)\ **Replies:** 8\ **Last updated:** [January 10, 2008, 10:09pm UTC](https://www.ruby-forum.com/t/string-extraction/125639 "2008-01-10T22:09:03Z")
Hi all, What is the Ruby way to extract a string like this? old\_string=“5’-AAAAAAAA CCCCCCCC TTT GGGGG GGGG-3’” new\_string=“AAAAAAAACCCCCCCCTTTGGGGGGGGG” Thank you very much, Li --- ## [Rescu all errors and then case statement](https://www.ruby-forum.com/t/rescu-all-errors-and-then-case-statement/125614)
**Author:** [@nicpon](https://www.ruby-forum.com/u/nicpon)\ **Replies:** 5\ **Last updated:** [January 10, 2008, 9:12pm UTC](https://www.ruby-forum.com/t/rescu-all-errors-and-then-case-statement/125614 "2008-01-10T21:12:36Z")
How can I read what type of error occured in rescue clause. For example, I have the following: begin “some code here” rescue case when “error type 1” when “error type 2” end end I know I could raise errors with… --- ## [SVN Revision 71](https://www.ruby-forum.com/t/svn-revision-71/125618)
**Author:** [@John\_LSSDLR](https://www.ruby-forum.com/u/John_LSSDLR)\ **Replies:** 2\ **Last updated:** [January 10, 2008, 7:19pm UTC](https://www.ruby-forum.com/t/svn-revision-71/125618 "2008-01-10T19:19:10Z")
Whoops - sent to wrong list :slight\_smile: The major Ruby-visible change is the addition of super thanks to John Messerly. The constant generation bug that Peter reported is now fixed in this revision. You’ll also s… --- ## [Studying Blackjack (#151)](https://www.ruby-forum.com/t/studying-blackjack-151/125624)
**Author:** [@bbazzarrakk](https://www.ruby-forum.com/u/bbazzarrakk)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 6:19pm UTC](https://www.ruby-forum.com/t/studying-blackjack-151/125624 "2008-01-10T18:19:50Z")
The solutions took two totally different approaches this week. Some exhaustively searched the possible hands a dealer can have. The search space isn’t too big in this case so that’s a viable approach that gives exac… --- ## [Newbie questions](https://www.ruby-forum.com/t/newbie-questions/125615)
**Author:** [@pytlik](https://www.ruby-forum.com/u/pytlik)\ **Replies:** 1\ **Last updated:** [January 10, 2008, 6:02pm UTC](https://www.ruby-forum.com/t/newbie-questions/125615 "2008-01-10T18:02:51Z")
Hallo everybody. I discovered the Ruby Q. site some time ago and I’ve been much intrigued by the Ruby language. So I’ve begun trying to solve some of the old problems, and I’m very interested in learning Ruby to final… --- ## [IRB and the '?' character](https://www.ruby-forum.com/t/irb-and-the-character/125620)
**Author:** [@sohdubom](https://www.ruby-forum.com/u/sohdubom)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 5:52pm UTC](https://www.ruby-forum.com/t/irb-and-the-character/125620 "2008-01-10T17:52:50Z")
When I’m in an IRB session the ? character of my keyboard does not work. I’m using a notebook and in order to type the ‘?’ I go through a combination of the following keys: \ In case anyone has the similar … --- ## [System.Double question](https://www.ruby-forum.com/t/system-double-question/125566)
**Author:** [@editkid](https://www.ruby-forum.com/u/editkid)\ **Replies:** 1\ **Last updated:** [January 10, 2008, 4:07pm UTC](https://www.ruby-forum.com/t/system-double-question/125566 "2008-01-10T16:07:38Z")
I added this to the FloatOps class: \[RubyConstant\] public const double MAX = double.MaxValue; But this generated the following code in InitializerGenerated.cs: def11.SetConstant("MAX", 1.79769313486232E+3… --- ## [Linux -- require question](https://www.ruby-forum.com/t/linux-require-question/125600)
**Author:** [@spin-vector](https://www.ruby-forum.com/u/spin-vector)\ **Replies:** 2\ **Last updated:** [January 10, 2008, 2:53pm UTC](https://www.ruby-forum.com/t/linux-require-question/125600 "2008-01-10T14:53:31Z")
I’m a newbie. I’ve locally installed ruby and rubygems on my linux box (call it /home/). I’ve successfully installs rails and rake via gem install, however from irb I get: irb(main):002:0\> require ‘rails’ LoadError: … --- ## [Bug in 1.9.0 csv parser](https://www.ruby-forum.com/t/bug-in-1-9-0-csv-parser/125571)
**Author:** [@nicko](https://www.ruby-forum.com/u/nicko)\ **Replies:** 1\ **Last updated:** [January 10, 2008, 2:46pm UTC](https://www.ruby-forum.com/t/bug-in-1-9-0-csv-parser/125571 "2008-01-10T14:46:06Z")
Hi, I’ve found a bug in the 1.9.0 csvparser. I’ve got a script and data that effectively breaks it, but it is 567kb. Is that too large for this list? The ruby instance takes 100% of cpu while processing this file, … --- ## [Create image, send to rails](https://www.ruby-forum.com/t/create-image-send-to-rails/125107)
**Author:** [@macaco](https://www.ruby-forum.com/u/macaco)\ **Replies:** 7\ **Last updated:** [January 10, 2008, 2:33pm UTC](https://www.ruby-forum.com/t/create-image-send-to-rails/125107 "2008-01-10T14:33:10Z")
Hi, I’m new to this language, so any help will be welcome. I’m trying to create images at random, not a problem with this, and I can do it on ruby alone saving the image to the filesystem and watching it later on a … --- ## [Method that generate block?](https://www.ruby-forum.com/t/method-that-generate-block/125500)
**Author:** [@xain](https://www.ruby-forum.com/u/xain)\ **Replies:** 5\ **Last updated:** [January 10, 2008, 2:30pm UTC](https://www.ruby-forum.com/t/method-that-generate-block/125500 "2008-01-10T14:30:48Z")
Hi, could anyone tell me how to code a method/methods that generates these blocks? thanks. vds\[0\].each do |d0| vds\[1\].each do |d1| … vds\[n\].each do |dn| ds = \[d0, d1…, dn\] create\_new\_filter(ds) end end … end --- ## [How to remove a method from an object?](https://www.ruby-forum.com/t/how-to-remove-a-method-from-an-object/125573)
**Author:** [@Valerio\_S](https://www.ruby-forum.com/u/Valerio_S)\ **Replies:** 8\ **Last updated:** [January 10, 2008, 1:56pm UTC](https://www.ruby-forum.com/t/how-to-remove-a-method-from-an-object/125573 "2008-01-10T13:56:12Z")
hello everyone, how can I remove a method from an object, without impacting future instances of its class ? say: class Server def print puts ‘hello’ end end s1 = Server.new s1.print #this work #now remove prin… --- ## [Dde "wait loop"](https://www.ruby-forum.com/t/dde-wait-loop/125370)
**Author:** [@ernsttanaka](https://www.ruby-forum.com/u/ernsttanaka)\ **Replies:** 6\ **Last updated:** [January 10, 2008, 12:55pm UTC](https://www.ruby-forum.com/t/dde-wait-loop/125370 "2008-01-10T12:55:47Z")
I have a question on DDE I use the following command; d = tk\_call(‘dde’, ‘request’, ‘TOS’, ‘DESCRIPTION’, x.opra) it seems that the call doesnot always give data while I am sure data is available. Tested via a dde c… --- ## [Unknown ole server AchroExch.app](https://www.ruby-forum.com/t/unknown-ole-server-achroexch-app/125587)
**Author:** [@flamingflamingo](https://www.ruby-forum.com/u/flamingflamingo)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 11:50am UTC](https://www.ruby-forum.com/t/unknown-ole-server-achroexch-app/125587 "2008-01-10T11:50:51Z")
Hi, I’m trying to work with PDF’s. When I use the line: PDF = WIN32OLE.new(‘AcroExch.App’) i get the next message: initialize': unknown OLE server:AcroExch.App’ (WIN32OLERuntimeError) Has anyone had this problem be… --- ## [Queue and timeout](https://www.ruby-forum.com/t/queue-and-timeout/125156)
**Author:** [@Tanaka\_A](https://www.ruby-forum.com/u/Tanaka_A)\ **Replies:** 8\ **Last updated:** [January 10, 2008, 11:48am UTC](https://www.ruby-forum.com/t/queue-and-timeout/125156 "2008-01-10T11:48:13Z")
timeout e$B$Ge(B Queue#pop e$B$K;~4V@)8B$r$D$1$?;~!“%?%$%\`%”%&%H;~$Ke(B Timeout::Error e$B$G$J$/e(B ThreadError e$B$,H/@8$7$^$9!#e(B % ./ruby -v -rtimeout -rthread -e ’ q = Queue.new timeout(1) { q.pop } ’ ruby 1.9… --- ## [\[newbie\] windows renaming](https://www.ruby-forum.com/t/newbie-windows-renaming/125586)
**Author:** [@tnntwister](https://www.ruby-forum.com/u/tnntwister)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 11:43am UTC](https://www.ruby-forum.com/t/newbie-windows-renaming/125586 "2008-01-10T11:43:08Z")
Hello, i’m beginning to use Ruby, but i can’t find examples of renaming with the Dir class. I’ve tried a code lign like this : Dir.glob(“C:\\Documents?and?Settings\\NET?DESIGN\\Mes?documents\\Mes?images\\\*”) { |name| cop… --- ## [Struct equivalent with rails-y keyword args hash?](https://www.ruby-forum.com/t/struct-equivalent-with-rails-y-keyword-args-hash/125445)
**Author:** [@Giles\_B](https://www.ruby-forum.com/u/Giles_B)\ **Replies:** 10\ **Last updated:** [January 10, 2008, 9:49am UTC](https://www.ruby-forum.com/t/struct-equivalent-with-rails-y-keyword-args-hash/125445 "2008-01-10T09:49:15Z")
I have some code which uses Structs. I’d rather use keyword args. I’m generating data objects to store MIDI note data, and it’s kind of hideously unreadable: Note.new(2, 43, 0.25, 127, now += interval) This would be … --- ## [How can i get rubys on rails on my computer(fast and ez)?](https://www.ruby-forum.com/t/how-can-i-get-rubys-on-rails-on-my-computer-fast-and-ez/122878)
**Author:** [@unknown](https://www.ruby-forum.com/u/unknown)\ **Replies:** 5\ **Last updated:** [January 10, 2008, 7:25am UTC](https://www.ruby-forum.com/t/how-can-i-get-rubys-on-rails-on-my-computer-fast-and-ez/122878 "2008-01-10T07:25:51Z")
How can i get rubys on rails on my computer(fast and ez)? --- ## [List All Required Files](https://www.ruby-forum.com/t/list-all-required-files/125562)
**Author:** [@dbf](https://www.ruby-forum.com/u/dbf)\ **Replies:** 1\ **Last updated:** [January 10, 2008, 5:50am UTC](https://www.ruby-forum.com/t/list-all-required-files/125562 "2008-01-10T05:50:04Z")
Is there a way to list all the files that have been required by a script recursively? In other words is the hash of already required files readable? Thanks, Dan --- ## [Binmode and ASCII-8BIT](https://www.ruby-forum.com/t/binmode-and-ascii-8bit/125474)
**Author:** [@Kazuhiro\_NISHIYAMA](https://www.ruby-forum.com/u/Kazuhiro_NISHIYAMA)\ **Replies:** 5\ **Last updated:** [January 10, 2008, 3:56am UTC](https://www.ruby-forum.com/t/binmode-and-ascii-8bit/125474 "2008-01-10T03:56:06Z")
e$B@\>;3OB9-$G$9!#e(B http://dontstopmusic.no-ip.org/diary/20080106.html#p02 e$B$r8+$F$A$g$C$HD4$Y$F$\_$?$N$G$9$,!"e(B binmode e$B$Ge(B external\_encoding e$B$,e(B ASCII-8BIT e$B$K$J$ke(B external\_encoding e$B$,e(B ASCI… --- ## [GINA is the new most popular 'mains' of 1 email account](https://www.ruby-forum.com/t/gina-is-the-new-most-popular-mains-of-1-email-account/125552)
**Author:** [@bicomplex](https://www.ruby-forum.com/u/bicomplex)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 2:45am UTC](https://www.ruby-forum.com/t/gina-is-the-new-most-popular-mains-of-1-email-account/125552 "2008-01-10T02:45:52Z")
It was already mainstream that the form of the default email account was most of the time with just 4 chars. ‘info’ is still the most popular. Most popular still than ‘mail’, ‘main’, and so on… Now, the new popular fo… --- ## [Submit a form using link](https://www.ruby-forum.com/t/submit-a-form-using-link/125545)
**Author:** [@fries88](https://www.ruby-forum.com/u/fries88)\ **Replies:** 1\ **Last updated:** [January 10, 2008, 2:17am UTC](https://www.ruby-forum.com/t/submit-a-form-using-link/125545 "2008-01-10T02:17:42Z")
I have problem submiting a form using a link. Can anyone please help me? --- ## [Embedding 1.9](https://www.ruby-forum.com/t/embedding-1-9/125287)
**Author:** [@dirtytree](https://www.ruby-forum.com/u/dirtytree)\ **Replies:** 33\ **Last updated:** [January 10, 2008, 2:04am UTC](https://www.ruby-forum.com/t/embedding-1-9/125287 "2008-01-10T02:04:55Z")
Folks: I’m working on the “Extending Ruby” chapter (now an appendix) for the third PickAxe, and I’m finding a whole bunch of conflicting information. Reading the source, it seems like there’s no canonical way of embe… --- ## [ZenTest 3.7.2 Released](https://www.ruby-forum.com/t/zentest-3-7-2-released/125543)
**Author:** [@aguynamedryan](https://www.ruby-forum.com/u/aguynamedryan)\ **Replies:** 0\ **Last updated:** [January 10, 2008, 2:03am UTC](https://www.ruby-forum.com/t/zentest-3-7-2-released/125543 "2008-01-10T02:03:45Z")
ZenTest version 3.7.2 has been released! http://www.zenspider.com/ZSS/Products/ZenTest/ http://rubyforge.org/projects/zentest/ removed\_email\_address@domain.invalid ZenTest provides 4 different tools and 1 library: zen… --- ## [\[ANN\] Thin 0.5.1 LOLCAT released](https://www.ruby-forum.com/t/ann-thin-0-5-1-lolcat-released/125320)
**Author:** [@macournoyer](https://www.ruby-forum.com/u/macournoyer)\ **Replies:** 12\ **Last updated:** [January 10, 2008, 1:04am UTC](https://www.ruby-forum.com/t/ann-thin-0-5-1-lolcat-released/125320 "2008-01-10T01:04:07Z")
Hey all, Version 0.5.1 (codename LOLCAT) of the fastest Ruby server is out! Thin is a Ruby web server that glues together 3 of the best Ruby libraries in web history: the Mongrel parser: the root of Mongrel speed an… [Previous page](https://www.ruby-forum.com/c/ruby/7.md?page=1240) [Next page](https://www.ruby-forum.com/c/ruby/7.md?page=1242)